Seqviz (DNA/RNA map)

Shows a DNA, RNA, or protein sequence as a circular or linear map, marking the regions (annotations) on it.

Syntax

```seqviz
{"name":"example","seq":"ATGCGTACGTAGCTAGCTAGGCTA","annotations":[{"name":"region-1","start":0,"end":10}]}
```

The content is JSON passed to the seqviz library's own viewer component: at minimum a seq (sequence) field is required, while name and annotations (for labeling specific ranges of the sequence) are optional.

What it's for

Showing a gene/plasmid map while marking a specific region (e.g. a promoter or a coding region). Useful in biology notes.

Source

Official documentation for all the options the library accepts (view type, colors, additional annotation fields): github.com/Lattice-Automation/seqviz. The fields you write in the JSON correspond directly to this library's own props schema, so you should check the full field list there while writing.

Tsunagi-specific note

By default, the library tries to download a web font on first load; Tsunagi disables this and uses the system font instead, so it works entirely offline.